How To Detect Phosphorylated Protein

With Regards To Using Stain

Tips and tricks: Phospho Western Blots

It is better practice to use the Stain-Free blot image for total protein normalization, since variability in transferring your proteins to the membrane could result in differences between samples not captured by the Stain-Free gel image. To reduce the background in these images, use low-fluorescent PVDF membrane.

Visit bio-rad-antibodies.com/phospho-PrecisionAb. Contact your local sales representative, or our technical support team, for more information.

Comparison With Other Methods

Acrylamide pendant Phos-Tag identification and monitoring of protein phosphorylation is a small scale method and thus will be compared to similar approaches. The identification of phosphorylated protein species and their subsequent quantitative analysis requires their efficient separation from their non-phosphorylated counterparts. In small scale experiments, phosphorylation can be monitored by metabolic labeling of phosphorylated proteins with radioactive ATP . Radioactive phosphorus is a beta emitter and exhibits the highest emission energy compared to other biologically used radioisotopes. For this reason 32P-ATP handling requires dedicated laboratory space, equipment and special training of the personnel, adhering to institutional rules for storage, handling and disposal of radioactive waste. Although 32P-ATP comes at affordable prices by many vendors, the health risks and the cost for establishing appropriate laboratory space and training of handling personnel make the use of 32P-ATP prohibitive especially for research groups that only occasionally study protein phosphorylation.

Alternatively, protein phosphorylation may be semi quantitatively addressed on standard immunoblots following denaturing SDS PAGE with phosphorylation specific antibodies . Although some commonly used phospho-specific antibodies are commercially available most will have to be custom ordered at a significant cost.

Probing For The Total Protein

Using an antibody that detects the total level of your target protein enables you to determine the phosphorylated fraction relative to the total fraction. This allows you to compare the impact of different treatments and provides an internal loading control . A simple way to do this is to multiplex, so you can look at the target total and phospho-protein at the same time . Visit bio-rad-antibodies.com/phospho-precisionab for more examples.

You May Like: Special K Protein Cereal Healthy

Assessment Of Transcripts In M Sativa Simkk Rnai Line By Rt

Transcript levels of SIMKK in the RNAi and the control Medicago sativa lines were quantified by RT qPCR of total RNA isolated from respective seedlings with Trizol® reagent using the following primer sets for SIMKK: CACCAGAAGCTCCAACGACTG and CGACGGGTCTCTCTGCAAAC , and the product was normalized against ACTIN2 transcript levels .

Monitoring Protein Phosphorylation By Acrylamide Pendant Phos

Western Blot Detection Of Phosphorylation Events Bioradiations
  • Department of Cell Biology, Centre of the Region Haná for Biotechnological and Agricultural Research, Palacký University Olomouc, Olomouc, Czech Republic

The aim of the present study is to rationalize acrylamide pendant Phos-Tag in-gel discrimination of phosphorylated and non-phosphorylated plant protein species with standard immunoblot analysis, and optimize sample preparation, efficient electrophoretic separation and transfer. We tested variants of the method including extraction buffers suitable for preservation of phosphorylated protein species in crude extracts from plants and we addressed the importance of the cation used in the gel recipe for efficient transfer to PVDF membranes for further immunoblot analysis. We demonstrate the monitoring of Medicago sativa stress-induced mitogen activated protein kinase in stress-treated wild type plants and transgenic SIMKK RNAi line. We further show the hyperosmotically-induced phosphorylation of the previously uncharacterized HvMPK4 of barley. The method is validated using inducible phosphorylation of barley and wheat -tubulin and of Arabidopsis MPK6. Acrylamide pendant Phos-Tagoffers a flexible tool for studying protein phosphorylation in crops and Arabidopsis circumventing radioactive labeling and the use of phosphorylation specific antibodies.

Don’t Miss: Cholesterol In Protein Powder Good Or Bad

Phosphorylation Of Monocot Proteins

Next we used Phos-Tag electrophoretic separation to document phosphorylation of alpha-tubulin in hyperosmotically-treated Hordeum vulgare and Triticum turgidum seedlings as previously published for Oryza sativa and Arabidopsis thaliana . In the case of Hordeum vulgare, the efficient separation and detection of hyperosmotically-induced protein phosphorylation was further validated in the case of barley MAPK detected with a custom raised antibody.

Tubulin phosphorylation was also followed in extracts of hyperosmotically-treated wheat seedlings. By standard SDS-PAGE and subsequent western blot, alpha-tubulin immunoreactivity was detected as a single band, showing slight upregulation of alpha-tubulin intensity after the hyperosmotic treatment . As previously described for barley, Zn2+/Phos-Tag gels discriminated tubulin immunoreactivity in two bands, the upper one of which likely corresponded to phosphorylated alpha-tubulin while the lower one corresponded to non-phosphorylated alpha tubulin .

Applications Of The Method

We have used acrylamide pendant Phos-Tag to delineate the phosphorylation status of the microtubule associated protein 65-1 in four MAPK-related mutants of Arabidopsis thaliana and also showed phosphorylation of AtMPK4 under conditions of hyperosmotic stress in wild type Arabidopsis thaliana seedlings . Moreover, we showed phosphorylation of MAP65-1 ortholog of Vigna sinensis following hyperosmotic stress .

In the plant science, acrylamide pendant Phos-Tag had been further used to demonstrate alpha-tubulin phosphorylation in Arabidopsis thaliana and rice following hyperosmotic and salt stress or antimicrotubular drug treatments associated with the function of an atypical kinase originally identified as phosphatase . Phos-Tag was also used to follow the pathogen elicited phosphorylation of either plant or pathogen proteins during the development of innate immune responses and the MPK6-mediated phosphorylation of ethylene responsive factor ERF104 and the BES1 transcription factor among others.

Recommended Reading: Shakeology Vs Premier Protein

Mapping Of Sites Phosphorylated In Vitro

The best mapping results come from an approach that combines data obtained in vivo and in vitro. Thus it is preferable to develop an in vitro reconstituted system to generate phosphorylated protein for analysis. To obtain good sequence coverage and quality spectra that yield high-confidence phosphopeptide matches, it is best to obtain as much phosphorylated protein as possible. The amount of starting material required for successful analysis will vary widely, but a more is better rule should apply. High-occupancy sites on MS-friendly peptides may be detectable from as little as 2 pmol of total protein however, much higher levels are often required.

Ideally, controls should be carried out when establishing the in vitro system to ensure that the kinase of interest is directly responsible for phosphorylation of the protein. Use of a kinase-dead control, specific kinase inhibitors, or analogue-sensitive kinase mutants can help rule out the possibility that phosphorylation is due to a copurifying kinase.

Procedure For Detection Of Phosphorylated Proteins In Western Blot

Tips and tricks: Phospho Immunofluorescence

Related

Homogenize the cells or tissue of interest in lysis buffer made fresh and containing a cocktail of protease inhibitors .As soon as lysis occurs, proteolysis, dephosphorylation and denaturation begin. These events can be slowed down tremendously if samples are kept on ice or at 4°C at all times and appropriate inhibitors are added fresh to the lysis buffer.Use a RIPA or NP40 buffer supplemented with fresh protease and phosphatase inhibitor cocktails.

Remember to add phosphatase inhibitors to cocktails bought when investigating phosphorylation events.

  • To a sample of protein solution containing 1-100 ng of the target protein , add an equal volume of 2x SDS-PAGE sample buffer. For reduced samples, the sample buffer should be supplemented with DTT or ß-mercaptoethanol. For non-reduced samples, the DTT or ß-mercaptoethanol is not added.
  • Denature the proteins by heating the sample to 95°C, or boiling, for 5 min.
  • Load the sample onto an SDS-polyacrylamide gel and run the gel under standard conditions.
  • Transfer the proteins to a PVDF membrane using semi-dry or wet transfer methods. Please note: for PVDF it is essential to pre-wet the membrane in methanol prior to transfer.
  • If required, the efficiency of transfer can be determined by staining the membrane briefly in Ponceau stain. The stain can be removed by washing in PBST or TBST. We would recommend not washing blots in distilled water as this can strip off proteins in some circumstances.
  • Perform ECL Plus detection.
  • Also Check: Cholesterol In Protein Powder

    Ive Managed To Acquire An Antibody Against My Phosphorylated Protein Of Interest But It Has The Same Host Species As My Samples Is There A Way I Can Use This Antibody Without Detecting The Endogenous Igg In My Sample

    Use a conformation specific secondary reagent, like Bio-Rads TidyBlot Reagent, which only detects the native conformation of an antibody and not the denatured endogenous IgG in your samples. This means that the heavy and light chains from the antibodies in your sample will not be detected. The only band that should appear on your blot is from your antibody detecting the phosphorylated target.

    Which Controls Should I Use

    Consider the following controls:

    • Positive and negative controls: confirm antibody specificity by including samples stimulated to induce phosphorylation at your site of interest and by performing phosphatase treatment. You can also include a negative control such as cells treated with a specific kinase inhibitor
    • Total protein controls: present data for each phospho-specific antibody alongside data from an antibody recognizing the total protein. This will provide you with absolute confidence in the specificity of your phospho-specific antibody and determine if expression of the target protein is up- or downregulated
    • Loading controls: popular loading controls include housekeeping proteins, such as beta-actin or beta-tubulin. As an alternative, you can also use dyes like Ponceau S or Bio-Rads Stain-Free imaging technology

    Fig. 1. Western blot detection of total and phospho EGF R. MDA-MB-468 untreated and EGF treated whole cell lysates were probed with A, Human Anti-EGF R Antibody or B, Human Anti-EGF R Antibody followed by detection with HRP conjugated Human Anti-Bacterial Alkaline Phosphatase .

    Also Check: Nature Valley Protein Bars Bodybuilding

    Intracellular Flow Cytometry :

    Human peripheral blood lymphocytes were stimulated with , or without , Cell Activation Cocktail for 15 minutes, then fixed with Fixation Buffer, permeabilized with True-Phos⢠Perm Buffer, and intracellularly stained with ERK1/2 Phospho Alexa Fluor® 647.

    C57BL/6 mouse splenocytes were stimulated with or without Cell Activation Cocktail for 15 minutes, then fixed with Fixation Buffer, permeabilized with True-Phos⢠Perm Buffer, and intracellularly stained with ERK1/2 Phospho Alexa Fluor® 647.

    Look At The Total Protein

    Methods for Detecting Protein Phosphorylation: R& D Systems

    What if you develop your blot and you have no signal? Is it because your protein isnt phosphorylated or is it because you havent efficiently isolated your protein? One way to know the difference is to always include a control in which you probe for the total protein, regardless of phosphorylation state. Many companies sell paired antibodies that recognize unmodified or phosphorylated forms of proteins, to help you out with this.

    Don’t Miss: Protein Powder Like Shakeology

    Tips For Detect Phosphorylated Proteins

    Hi, there,recently I tried to do western to detect phosphorylated proteins, but it never worked. Everytime there is a high-molecular weight band in each lane. I don’t know what is wrong. When I reprobe with other antibody, like non-phosphorylated or actin, they woked well. Does anybody have any idea about it? thanks a lot.

    well use 4%BSA in TBST for blockingDon’t use tween in 1st AB ans washesuse TBST with your 2nd ab.Transfert gently and use NaF in all solutions of AB 1st AB ovenight 4°C and second 1h at least don’t check by ponceau or coomassie the transfert. better is to stain the gel

    Obtaining Quantitative Information Can Be Important

    Advances in phosphoproteomics have led to a data explosion. More than 100,000 different phosphorylation sites have been reported in literature-curated databases . It is unclear, however, how many of these sites are physiologically relevant. Indeed, numerous studies have reported mutating mapped sites with little or no effect on function or phenotype, and many more such observations have almost certainly gone unreported. There are two important technical issues that can lead to identification of phosphorylation sites that are not physiologically relevant. First, standard mass spectrometry provides no information on the stoichiometry of the phosphorylation site. This is because phosphorylated and unphosphorylated peptides are chemically distinct and therefore behave differently during mass spectrometry. Thus it is not possible to determine the stoichiometry of phosphorylation simply by comparing the amounts of phosphorylated and unphosphorylated peptide. Second, methods for phosphopeptide enrichment, coupled with leaps in instrument sensitivity, have enabled the detection of very low occupancy sites. Together these considerations mean that mass spectrometry can detect peptides that are phosphorylated at such low stoichiometry that they may be meaningless. Fortunately, quantitative mass spectrometry methods, which can measure the stoichiometry of phosphorylation or relative changes in phosphorylation, can help zero in on biologically relevant sites.

    Read Also: Vega One Compared To Shakeology

    The Basics Of Phosphorylation

    In the simplest mapping experiment, a purified protein is digested with a protease that cuts at defined sites to produce small peptides. Tandem mass spectrometry is used to measure intact peptide masses and fragment ion masses. Computer algorithms then identify peptides by matching these experimental data to theoretical spectra derived from sequence databases . Phosphopeptide mapping is accomplished by matching the data to theoretical spectra that consider all possible phosphorylated versions of each peptide . A number of commercial and open-source search algorithms are widely available . Although each is subject to its own caveats and hurdles, most known small covalent posttranslational modifications can also be mapped using these principles.

    Mapping Sites On Isolated Proteins Versus Large

    Tips and tricks: Phospho Flow Cytometry

    The development of efficient methods for phosphopeptide enrichment, along with improvements in sensitivity and the maturation of quantitative methods, has made it possible to identify and quantify > 10,000 sites from thousands of proteins in a day or two of mass spectrometric analysis . In this kind of experiment, cells are subjected to an experimental manipulation, and proteome-wide changes in phosphorylation are detected by comparison to a control sample. This approach has proven to be extraordinarily powerful for mapping signaling networks. However, it provides minimal sequence coverage of individual proteins, and many proteins, especially those of lower abundance, will be missed completely. Therefore it cannot provide detailed phosphorylation-site information for individual proteins.

    You May Like: Equivalent To Shakeology

    Plant Material And Treatments

    In the present study we used seedlings of Medicago sativa cv. Regen SY , Hordeum vulgare cv. Golden Promise, Triticum turgidum cv. Athos and Arabidopsis thaliana ecotype Columbia . Before plating, seeds of Arabidopsis thaliana and Medicago sativa and caryopses of Hordeum vulgare and Triticum turgidum, were appropriately surface sterilized first with 70% v/v aqueous ethanol for 2 min and subsequently with 10% v/v aqueous bleach solution supplemented with 0.01% v/v Tween-20 for 10 min. Following washing with sterile, distilled water, all plant material was plated to ½Murashige Skoog nutrient medium solidified with 0.8% w/v Phytagel and allowed to grow in controlled environmental chambers with standard light:dark cycle / temperature / humidity settings. For treatments, 10 day old Arabidopsis thaliana seedlings were treated with 15 mM H2O2 in liquid ½MS for 30 min. 34 day old seedlings of Hordeum vulgare and Triticum turgidum were treated with 0.8 M sorbitol in liquid ½MS for 30 min. Wild type seedlings of Medicago sativa were treated with 250 mM NaCl, 15 mM H2O2, and 0.8 M sorbitol in liquid ½MS for 30 min and RNAi expressing Medicago sativa plants growing in soil pots were treated by wounding by lightly scoring leaves with a sharp razor blade and collected in liquid nitrogen 5 min post-wounding.

    Optimization Of Blocking Reagents

    Select the best blocking reagent for your antibody. For phosphorylated target analysis, start with casein in TBS or BSA. Using milk can lead to higher background as it contains proteins that could interfere with the target identification of phosphorylated proteins. Other blocking reagents such as chicken ovalbumin, fish gelatine, and commercially available synthetic blocking reagents may also provide viable alternatives. It is important to remember, when planning any western blot experiment, that there is no one-size-fits-all approach.

    Recommended Reading: Should I Drink Protein If I Want To Lose Weight

    Maldi Matrix Sample Preparation Protocols

    A CHCA thin-layer matrix was prepared and deposited on the AnchorChip sample support as described previously . Once dry, 1 µl of in-gel tryptic digest was deposited and thereafter re-crystallized on-target using 0.5 µl of re-crystallization solution . In addition, a DHB matrix layer was prepared and deposited on the AnchorChip sample support using the conditions detailed in . Without further modifications either 1 µl of in-gel tryptic digest or TiO2-MOAC enriched phosphopeptide extracts, were deposited to await MALDI-MS analysis.

    Detecting Protein Phosphorylation Without Radiation Phospho Specific Antibodies Or Mass Spec

    Methods For Detecting Protein Phosphorylation R D Systems

    Phosphorylation is one of the major post-translational modifications that regulate the activity of a protein. Around a third of human proteins are believed to be phosphorylated, and so the kinases and phosphatases that mediate protein phosphorylation are of major interest to biomedical researchers.

    However detecting protein phosphorylation can be difficult, particularly from cell extracts. Phospho-specific antibodies are useful if you already know you protein is phosphorylated, and on which residue, but if there isnt one already available making one is expensive, time consuming, and with no guarantee of success.

    If you dont have ready access to a mass spec facility, even finding if your favourite protein is phosphorylated in vivo is far from simple. Phosphorylation often causes proteins to migrate more slowly through acrylamide gels. Whilst this can allow you to monitor protein phosphorylation, it gives no indication how many times your protein is phosphorylated, and many phospho-proteins cant be detected in this way.

    Recommended Reading: What Does Protein In Your Kidneys Mean

    Salt Oxidative And Wound

    A prominent MAPK of Medicago sativa is SIMK which can be equally activated by exposure to hyperosmotic salt or sorbitol solutions or by wounding and oxidative stress . In all cases the strongest activator of SIMK is the MAPKK called SIMKK which can directly activate SIMK . Moreover, SIMK is a highly conserved homolog of AtMPK6 with absolute identity in the carboxylterminal region. Therefore, a commercial antibody generated against the 10 carboxylterminal residues of AtMPK6 can equally detect SIMK in appropriate western blots . For this reason we monitored the activation of Medicago sativa SIMK following salt, sorbitol and wounding stress in roots of either wild type seedlings or in leaves of wound-inflicted plants stably transformed with a siRNA SIMKK construct using this SIMK antibody. Therefore, this SIMKK silenced M. sativa line was used for further Phos-tag and western blot analyses.

    The activation of SIMK upon brief salt, H2O2 and sorbitol treatment of Medicago sativa roots was confirmed by western blot analysis of protein extracts acquired in buffer E and buffer B using a commercial anti-pTEpY antibody .

    Extracts in buffer E and buffer B were separated in Zn2+/Phos-Tag gel and immunoprobed with anti-SIMK antibody resulting in two well discriminated bands in both cases separating unphosphorylated and phosphorylated SIMK .

    Popular Articles

    Related Articles